zur [2018-12-18 16:30:22]

transcriptional repressor, regulates zinc homeostasis

Locus: BSU25100

Isoelectric point: 4.86

Molecular weight: 16.42 kDa

Protein length: 145 aa

Gene length: 435 bp

Function: regulation of zinc homeostasis(zagA, znuA-znuC-znuB)

Product: transcriptional repressor (Fur family)

Essential: no

Synonyms: yqfV

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Homeostasis → Trace metal homeostasis (Cu, Zn, Ni, Mn, Mo) → Zinc
• Information processing → Regulation of gene expression → Transcription factors and their control → Transcription factors/ other
• Groups of genes → Phosphoproteins → Phosphorylation on either a Ser, Thr or Tyr residue

Gene

Coordinates: 2,591,428 → 2,591,865

The protein

Protein family

• Fur family

Paralogous protein(s)

• Fur, PerR

Modification

• phosphorylated on ser/ thr/ tyr PubMed

Effectors of protein activity

• sequential binding of zinc (two atoms per monomer) results in the activation of Zur dimer and thus in repression of the genes of the Zur regulon PubMed
• zinc binding is negatively co-operative resulting in step-wise induction of the genes of the Zur regulon upon zinc depletion PubMed

Localization

• information on binding sites can be found in the PRODORIC2 database

Expression and Regulation

Operons

• Genes: yqfU-zur
  Description: PubMed

Biological materials

Mutant

• 1A904 ( zur::spec), PubMed, available at BGSC
• BKE25100 (Δzur::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGAAGGGTCCCCCTTTTC, downstream forward: _UP4_TAAAATGCGTATATATGAAA
• BKK25100 (Δzur::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGAAGGGTCCCCCTTTTC, downstream forward: _UP4_TAAAATGCGTATATATGAAA

Labs working on this gene/protein

• John Helmann, Cornell University, USA Homepage

References

Loading